entrez geo Search Results


geo type entrez geo attrs text gse63409 term id 63409  (ATCC)
90
ATCC geo type entrez geo attrs text gse63409 term id 63409
KEY RESOURCES TABLE
Geo Type Entrez Geo Attrs Text Gse63409 Term Id 63409, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/geo type entrez geo attrs text gse63409 term id 63409/product/ATCC
Average 90 stars, based on 1 article reviews
geo type entrez geo attrs text gse63409 term id 63409 - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier
entrez geo  (Thermo Fisher)
92
Thermo Fisher entrez geo
KEY RESOURCES TABLE
Entrez Geo, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/entrez geo/product/Thermo Fisher
Average 92 stars, based on 1 article reviews
entrez geo - by Bioz Stars, 2026-02
92/100 stars
  Buy from Supplier
gene expression omnibus gse110271  (Biotechnology Information)
90
Biotechnology Information gene expression omnibus gse110271
KEY RESOURCES TABLE
Gene Expression Omnibus Gse110271, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene expression omnibus gse110271/product/Biotechnology Information
Average 90 stars, based on 1 article reviews
gene expression omnibus gse110271 - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier
gene expression microarray data gse17065  (Biotechnology Information)
90
Biotechnology Information gene expression microarray data gse17065
KEY RESOURCES TABLE
Gene Expression Microarray Data Gse17065, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene expression microarray data gse17065/product/Biotechnology Information
Average 90 stars, based on 1 article reviews
gene expression microarray data gse17065 - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier
mouse genome 430a 2.0  (Thermo Fisher)
90
Thermo Fisher mouse genome 430a 2.0
KEY RESOURCES TABLE
Mouse Genome 430a 2.0, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse genome 430a 2.0/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
mouse genome 430a 2.0 - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier
oryzae genechip microarray (aodnachip  (Thermo Fisher)
90
Thermo Fisher oryzae genechip microarray (aodnachip
KEY RESOURCES TABLE
Oryzae Genechip Microarray (Aodnachip, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/oryzae genechip microarray (aodnachip/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
oryzae genechip microarray (aodnachip - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier
human genome u133 plus 2.0 array  (Thermo Fisher)
90
Thermo Fisher human genome u133 plus 2.0 array
KEY RESOURCES TABLE
Human Genome U133 Plus 2.0 Array, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human genome u133 plus 2.0 array/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
human genome u133 plus 2.0 array - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier
human610-quad v1.0  (Illumina Inc)
90
Illumina Inc human610-quad v1.0
Description of the four data sets and patient demographics. Number of samples from each study utilized in the combined analysis following removal of individuals with non-European genetic ancestry, sex mismatches, and related samples within and between data sets
Human610 Quad V1.0, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human610-quad v1.0/product/Illumina Inc
Average 90 stars, based on 1 article reviews
human610-quad v1.0 - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier
arrays  (Thermo Fisher)
86
Thermo Fisher arrays
Description of the four data sets and patient demographics. Number of samples from each study utilized in the combined analysis following removal of individuals with non-European genetic ancestry, sex mismatches, and related samples within and between data sets
Arrays, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/arrays/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
arrays - by Bioz Stars, 2026-02
86/100 stars
  Buy from Supplier
pgc checksum algorithm  (Broad Institute Inc)
90
Broad Institute Inc pgc checksum algorithm
Description of the four data sets and patient demographics. Number of samples from each study utilized in the combined analysis following removal of individuals with non-European genetic ancestry, sex mismatches, and related samples within and between data sets
Pgc Checksum Algorithm, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pgc checksum algorithm/product/Broad Institute Inc
Average 90 stars, based on 1 article reviews
pgc checksum algorithm - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier
humanwg-6 v3 beadarrays  (Illumina Inc)
90
Illumina Inc humanwg-6 v3 beadarrays
Description of the four data sets and patient demographics. Number of samples from each study utilized in the combined analysis following removal of individuals with non-European genetic ancestry, sex mismatches, and related samples within and between data sets
Humanwg 6 V3 Beadarrays, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/humanwg-6 v3 beadarrays/product/Illumina Inc
Average 90 stars, based on 1 article reviews
humanwg-6 v3 beadarrays - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier
gene expression omnibus (geo) database  (Biotechnology Information)
90
Biotechnology Information gene expression omnibus (geo) database
Description of the four data sets and patient demographics. Number of samples from each study utilized in the combined analysis following removal of individuals with non-European genetic ancestry, sex mismatches, and related samples within and between data sets
Gene Expression Omnibus (Geo) Database, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene expression omnibus (geo) database/product/Biotechnology Information
Average 90 stars, based on 1 article reviews
gene expression omnibus (geo) database - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

Image Search Results


KEY RESOURCES TABLE

Journal: Cell systems

Article Title: Loss of TET2 affects proliferation and drug sensitivity through altered dynamics of cell-state transitions

doi: 10.1016/j.cels.2020.06.003

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies PE Mouse anti-Human CD34 BD Biosciences 555822 PE-Cy5 Mouse anti-Human CD38 BD Biosciences 555461 Chemicals, Peptides, and Recombinant Proteins Cytosine Beta-D-Arabinofuranoside Sigma-Aldrich C6645 Disulfiram Sigma-Aldrich D2950000 Human IFN-g PeproTech 300-02 Critical Commercial Assays CellTiter-Glo 2.0 Cell Viability Assay Promega G9242 QuantSeq 3’ mRNA-Seq Library Prep Kit FWD for Illumina Lexogen 0.15.24/96 MethoCult H4034 Optimum STEMCELL #04034 Deposited Data Raw and analyzed data This paper; Mendeley data doi: 10.17632/xmvz47rpg6.1 Epigenome analysis of leukemia stem, blast and normal hematopoietic stem/progenitor cells Jung et al., 2015 ; GEO {"type":"entrez-geo","attrs":{"text":"GSE63409","term_id":"63409"}} GSE63409 Experimental Models: Cell Lines Human male: KG-1 ATCC CCL-246; RRID: CVCL_0374 Human male: THP-1 ATCC TIB-202; RRID: CVCL_0006 Oligonucleotides Primer HOXA5-F: TCTCGTTGCCCTAATTCATCTTTT McLaughlin-Drubin et al., 2011 N/A Primer HOXA5-R: CATTCAGGACAAAGAGATGAACAGA McLaughlin-Drubin et al., 2011 N/A Primer CD38-F: CACCAAGCGCTTTCCCGAGACC This paper N/A Primer CD38-R: GAGAGGCCCCTCCAGTGCAGAA This paper N/A Primer CORO1A-F: GTGGTCCGCTCCAGCAAGTTCC This paper N/A Primer CORO1A-R: CAGACCGTGGGCGCATTCTTGT This paper N/A Primer ITGAM-F: CTCCGTGGACGTGGACAGCAAC This paper N/A Primer ITGAM-R: AATGGCCACGTCCGTCAGCTTG This paper N/A Primer TAL1-F: GGGAGCCGGATGCCTTCCCTAT This paper N/A Primer TAL1-R: ACTTCATGGCCAGGCGGAGGAT This paper N/A Recombinant DNA pSpCas9(BB)-2A-Puro (PX459) V2.0 Addgene #62988 Software and Algorithms Code to generate all figures This paper; Mendeley data doi: 10.17632/xmvz47rpg6.1 Code pertaining to model This paper; GitHub https://github.com/AltschulerWu-Lab/tet2-dynamics DNA methylation age calculator Horvath, 2013 https://horvath.genetics.ucla.edu/html/dnamage/ R R Core Team, 2019 https://www.R-project.org MATLAB R2019a https://www.mathworks.com Open in a separate window KEY RESOURCES TABLE TET2 knockout in human AML cell lines increases stem-like signatures TET2 KO cells have altered dynamics between stem-like/differentiated states Altered cell-state switching dynamics provides fitness advantage in and out of drug

Techniques: Recombinant, Viability Assay, Software, DNA Methylation Assay

Description of the four data sets and patient demographics. Number of samples from each study utilized in the combined analysis following removal of individuals with non-European genetic ancestry, sex mismatches, and related samples within and between data sets

Journal: Clinical pharmacology and therapeutics

Article Title: A New Liver Expression Quantitative Trait Locus Map From 1,183 Individuals Provides Evidence for Novel Expression Quantitative Trait Loci of Drug Response, Metabolic, and Sex-Biased Phenotypes

doi: 10.1002/cpt.1751

Figure Lengend Snippet: Description of the four data sets and patient demographics. Number of samples from each study utilized in the combined analysis following removal of individuals with non-European genetic ancestry, sex mismatches, and related samples within and between data sets

Article Snippet: Genotyping , Illumina HumanHap300-Duo v2.0 (GEO: {"type":"entrez-geo","attrs":{"text":"GSE39036","term_id":"39036"}} GSE39036 ) , Illumina Human610-Quad v1.0 (GEO: {"type":"entrez-geo","attrs":{"text":"GSE26105","term_id":"26105"}} GSE26105 ) , Affymetrix GeneChip Human Mapping 500K , HumanHap 650Y.

Techniques: Expressing, Microarray